Sequence ID | >SRA1016296 |
Genome ID | SRR023846.439298 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 247 |
End posion on genome | 172 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cggagaattt |
tRNA gene sequence |
GGCAACATAGCTCAGTTGGTAGAGCACAGCACTGAAAATGCTGGTGTCGTTGGTTCGATT |
Downstream region at tRNA end position |
aaagaaaagg |
Secondary structure (Cloverleaf model) | >SRA1016296 Phe GAA t ACCA aaagaaaagg G - C G - C C - G A - T A - T C - G A - T T T T C A A C C A T G A A | | | | | G T C T C G G T T G G C G | | | | T T G G A G C T A A GTGTC C - G A - T G - C C - G A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |