Sequence ID | >SRA1016297 |
Genome ID | SRR023846.439394 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 134 |
End posion on genome | 210 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tcgacaccat |
tRNA gene sequence |
CGGGGTGTAGCTTAGCCTGGTAGAGCGCTACGTTCGGGACGTAGAGGCCGGAGGTTCGAA |
Downstream region at tRNA end position |
catgtccatc |
Secondary structure (Cloverleaf model) | >SRA1016297 Pro CGG t ACCA catgtccatc C - G G - C G - C G - C G - C T - A G - C T A T T C T C C A C G A A + | | | | G C T T C G G G A G G C T + | | | T T G G A G C G T A G AGGCC C - G T - A A - T C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |