Sequence ID | >SRA1016313 |
Genome ID | SRR023846.445464 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 107 |
End posion on genome | 37 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
cacaaaaata |
tRNA gene sequence |
GCAAGTATAGTTTAATGGTAGAACTTGGGACTTCCACTCTCATAATCTCGGTTCGAGCCC |
Downstream region at tRNA end position |
tatatcaaat |
Secondary structure (Cloverleaf model) | >SRA1016313 Gly TCC a Atat tatatcaaat G + T C - G A - T A - T G - C T - A A - T C G T G A G C C A A A A | | | | | G T T T T G C T C G G C G + | | | T T G G A A C T A T TAAT T - A G - C G + T G - C A - T C C T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |