Sequence ID | >SRA1016314 |
Genome ID | SRR023846.445767 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 107 |
End posion on genome | 193 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tccgcagcgt |
tRNA gene sequence |
GCGACCGTGGCGTAATTGGTAGCCGCAACAGGTTTAGGTCCTGTCGAGCGCAAGCTTGTG |
Downstream region at tRNA end position |
ctccttctga |
Secondary structure (Cloverleaf model) | >SRA1016314 Leu TAG t ACCA ctccttctga G - C C - G G - C A - T C - G C - G G - C T G T C G G T C A T A A G | | | | | G T T G C G G C C A G C G | | | T T G C C G C T A G A CGAGCGCAAGCTTGT A - T C - G A - T G - C G - C T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |