Sequence ID | >SRA1016318 |
Genome ID | SRR023846.446939 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 99 |
End posion on genome | 172 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
gccccgttgg |
tRNA gene sequence |
GGCCTCGTGGCGGAGTGGTTACGCAGAGGACTGCAAATCCTTGCACGGGGGTTCGATTCC |
Downstream region at tRNA end position |
ttgcccagtt |
Secondary structure (Cloverleaf model) | >SRA1016318 Cys GCA g TCCA ttgcccagtt G - C G - C C - G C - G T - A C - G G - C T T T C T C C C A G A G | + | | | G T G G C G G G G G G C G | | | T T G A C G C T T A GCAC G + T A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |