Sequence ID | >SRA1016321 |
Genome ID | SRR023846.447668 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 181 |
End posion on genome | 110 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
aaaaaaatta |
tRNA gene sequence |
GGATCTATAGTGTAGCGGTTATCATCCAGGTTTTCCATACCTGGGACGGGGGTTCGACTC |
Downstream region at tRNA end position |
ttttgttact |
Secondary structure (Cloverleaf model) | >SRA1016321 Gly TCC a Attc ttttgttact G - C G + T A - T T - A C - G T + G A - T T C T C C C T C A C G A A | | | + | G G T G T G G G G G G C G | | + T T T T C A T T A C GGAC C - G A - T G - C G - C T - A T T T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |