Sequence ID | >SRA1016326 |
Genome ID | SRR023846.452383 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 177 |
End posion on genome | 253 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
cggttttcgg |
tRNA gene sequence |
GGCGAAGTAGCTCAGCTGGTTAGAGCACGGGAATCATAATCCTGGGGTCGGGGGTTCAAG |
Downstream region at tRNA end position |
ctcgcggatt |
Secondary structure (Cloverleaf model) | >SRA1016326 Met CAT g ACCA ctcgcggatt G + T G - C C - G G - C A - T A - T G - C T G T C T C C C A C G A A | + | | | A T C T C G G G G G G C G | | | | T T G G A G C T T A A GGGTC C - G G + T G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |