Sequence ID | >SRA1016339 |
Genome ID | SRR023846.458635 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 179 |
End posion on genome | 254 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
gtcgcgcatg |
tRNA gene sequence |
GTGGGTATAGCTCAGCTGGTAGAGCGCCTGGTTGTGGTCTAGGAGGCCGCGGGTTCAAGC |
Downstream region at tRNA end position |
atggaaaggn |
Secondary structure (Cloverleaf model) | >SRA1016339 His GTG g CCCA atggaaaggn G - C T - A G - C G + T G - C T - A A - T C G T T G C C C A C G A A + | | | | A T C T C G G C G G G C G | | | | T T G G A G C T A G AGGCC C - G C - G T - A G + T G - C T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |