Sequence ID | >SRA1016342 |
Genome ID | SRR023846.459416 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 153 |
End posion on genome | 78 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
nagacacatg |
tRNA gene sequence |
GTGGCTATAGCTCAGTCGGTAGAGCACCGCGTTGTGGTCGCGGGGGTCGCGGGTTCAAGT |
Downstream region at tRNA end position |
gtcataccga |
Secondary structure (Cloverleaf model) | >SRA1016342 His GTG g CCCA gtcataccga G - C T - A G - C G - C C - G T - A A - T T G T T G C C C A T G A A + | | | | A C C T C G G C G G G C G | | | | T T G G A G C T A A GGGTC C - G C - G G - C C - G G - C T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |