Sequence ID | >SRA1016349 |
Genome ID | SRR023846.461128 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 92 |
End posion on genome | 21 |
Amino Acid | Pro |
Anticodon | AGG |
Upstream region at tRNA start position |
atacaagaac |
tRNA gene sequence |
GGGTGATTGGTCTAGTGGTATGATTCTTGCTTAGGGTGCAAGAGGTCGCGAGTTCGATTC |
Downstream region at tRNA end position |
attttttttg |
Secondary structure (Cloverleaf model) | >SRA1016349 Pro AGG c Cttt attttttttg G - C G - C G - C T - A G - C A - T T - A T T T C G C T C A G A G | | | | | G T T C T G G C G A G C G | | + T T G T G A T T A T AGGTC C - G T - A T - A G - C C - G T T T G A G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |