Sequence ID | >SRA1016357 |
Genome ID | SRR023846.462952 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 106 |
End posion on genome | 182 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cgcccgcgtc |
tRNA gene sequence |
GCACCAGTAGCTCAGCTGGATAGAGTACTGCCCTCCGAAGGCAGGGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
ccttctatcc |
Secondary structure (Cloverleaf model) | >SRA1016357 Arg CCG c ACCA ccttctatcc G - C C - G A - T C - G C - G A - T G - C T A T C G C C C A C G A A | + | | | G T C T C G G T G G G C G | | | + T T G G A G T A T A A GGGTC C - G T - A G - C C - G C - G C A T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |