Sequence ID | >SRA1016370 |
Genome ID | SRR023846.469303 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 196 |
End posion on genome | 270 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
caacaccccc |
tRNA gene sequence |
GGGGAATTAGCTCAGTTGGTTAGAGCGCTACCTTGACATGGTAGAGGTCGCCGGTTCGAA |
Downstream region at tRNA end position |
ccgatgccct |
Secondary structure (Cloverleaf model) | >SRA1016370 Val GAC c ACtg ccgatgccct G - C G - C G - C G G A - T A - T T - A T A T C G G C C A T G A A | | | | | G T C T C G G C C G G C G | | | | T T G G A G C T T A G AGGTC C - G T - A A - T C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |