Sequence ID | >SRA1016371 |
Genome ID | SRR023846.469304 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 142 |
End posion on genome | 216 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ccgcctctgc |
tRNA gene sequence |
TGGGGCGTCGCCAAGTGGTAAGGCAGCGGCTTTTGATGCCGCCATGCGCAGGTTCGAACC |
Downstream region at tRNA end position |
atccttcctg |
Secondary structure (Cloverleaf model) | >SRA1016371 Gln TTG c GCCA atccttcctg T - A G - C G - C G - C G - C C - G G - C C A T C G T C C A G A C | | | | | G T A C C G G C A G G C G | | | T T G A G G C T A A CATGC G - C C - G G - C G - C C - G T T T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |