Sequence ID | >SRA1016373 |
Genome ID | SRR023846.469855 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 57 |
End posion on genome | 128 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ttacgactaa |
tRNA gene sequence |
GAGAGCTTAACTTAATGGTAAAGTATGTGACTTTTAATCATTCCAATGTGAGTTCGAATC |
Downstream region at tRNA end position |
ttattataat |
Secondary structure (Cloverleaf model) | >SRA1016373 Lys TTT a Attt ttattataat G + T A - T G - C A - T G - C C - G T - A T A T T A C T C A A A A + | | | | G T T T C A G T G A G C G | | | | T T G A A G T T A A CCAAT T T G + T T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |