Sequence ID | >SRA1016377 |
Genome ID | SRR023846.470866 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 155 |
End posion on genome | 241 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
tgggcccagt |
tRNA gene sequence |
GCCGCCGTGGCGAAATTGGCAGACGCACCCGACTCCAAATCGGGCATCTTCACGGGTTTG |
Downstream region at tRNA end position |
tcggaactcc |
Secondary structure (Cloverleaf model) | >SRA1016377 Trp CCA t ACCA tcggaactcc G - C C - G C - G G - C C - G C - G G - C T G T C T C C C A T A A G | | | | | G T A G C G G A G G G C G | | | T T G A C G C C A G A CATCTTCACGGGTTT C - G C - G C - G G - C A - T C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |