Sequence ID | >SRA1016385 |
Genome ID | SRR023846.473843 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 183 |
End posion on genome | 98 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ccggcaccct |
tRNA gene sequence |
CGATCGGTGATGAAATGGCAGACATGACCGCCTCAAAAGCGGTGGCCTTCCCGGGCGTGA |
Downstream region at tRNA end position |
ggcagaaaca |
Secondary structure (Cloverleaf model) | >SRA1016385 Leu CAA t ACCA ggcagaaaca C - G G - C A - T T - A C - G G - C G - C T C T C T C C C A T A A G | | | | | G G A G T A G A G G G C G | | | T T C A C A T A G G GGCCTTCCCGGGCGT A - T C - G C - G G - C C - G C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |