Sequence ID | >SRA1016386 |
Genome ID | SRR023846.473961 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 7 |
End posion on genome | 88 |
Amino Acid | Ser |
Anticodon | AGA |
Upstream region at tRNA start position |
nnnntagcaa |
tRNA gene sequence |
GCAGTCGTGGCCGAGTGGTTAAGGCGACAGACTAGAAATCTGTTGGGCTCTGCCCGCACA |
Downstream region at tRNA end position |
aatctttttt |
Secondary structure (Cloverleaf model) | >SRA1016386 Ser AGA a Gaaa aatctttttt G - C C - G A - T G - C T - A C - G G - C T A T T G T C C A T G A G | | | | | G G G C C G A C A G G C G | | | T T T A G G C T A G TGGGCTCTGCCCGC A - T C - G A - T G - C A - T C A T A A G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |