Sequence ID | >SRA1016407 |
Genome ID | SRR023846.483332 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 177 |
End posion on genome | 105 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
gtgtcagtga |
tRNA gene sequence |
GTCAGTGTCGTCTAGTGGTTAGGACGCGAGCTTCACACGCTCGAGATCGAGGGTTCGATC |
Downstream region at tRNA end position |
tctttgctct |
Secondary structure (Cloverleaf model) | >SRA1016407 Val CAC a Atct tctttgctct G + T T - A C - G A - T G - C T T G - C C T T C T C C C A T G A C | | | | | G G T C T G G A G G G C G + | | | T T T G G A C T A G AGATC C - G G - C A - T G - C C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |