Sequence ID | >SRA1016421 |
Genome ID | SRR023846.489057 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 84 |
End posion on genome | 159 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
tgtctctcag |
tRNA gene sequence |
GGGCTCTTAGCTCAGTTGGTAGAGCAGCGGACTCTTAATCCGTAGGTCGAGTGTTCGAGT |
Downstream region at tRNA end position |
ccaacatcgc |
Secondary structure (Cloverleaf model) | >SRA1016421 Lys CTT g ACCA ccaacatcgc G - C G - C G - C C - G T + G C - G T - A T G T C T C A C A T G A A | | | | | G T C T C G G A G T G C G | | | | T T G G A G C T A A AGGTC G + T C - G G - C G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |