Sequence ID | >SRA1016422 |
Genome ID | SRR023846.489436 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 137 |
End posion on genome | 63 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
ctcctcgtac |
tRNA gene sequence |
GCGCCCTTCGTCTATCGGTTAGGACGTCAGATTTTCATTCTGAAAAGAGGGGTTCGACTC |
Downstream region at tRNA end position |
cttccccctt |
Secondary structure (Cloverleaf model) | >SRA1016422 Glu TTC c ACCA cttccccctt G + T C - G G - C C - G C - G C - G T - A T C T T C C C C A C T A C | | | | | G G T C T G A G G G G C G + | | | T T T G G A C T A G AAAG T - A C - G A - T G - C A - T T T T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |