Sequence ID | >SRA1016427 |
Genome ID | SRR023846.491695 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 50 |
End posion on genome | 124 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
aacgagtttc |
tRNA gene sequence |
GGGCGCGTAGCTCAGCGGTAGAGCACACCCTTCACACGGGTGGGGTCACAGGTTCAATCC |
Downstream region at tRNA end position |
gatttacgcc |
Secondary structure (Cloverleaf model) | >SRA1016427 Val CAC c ACCA gatttacgcc G - C G - C G - C C - G G - C C - G G - C C T T T G T C C A G A A | | | | | A C C T C G A C A G G C G | | | | T T G G A G C T A A GGGTC C - G A - T C - G C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |