Sequence ID | >SRA1016430 |
Genome ID | SRR023846.493481 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 96 |
End posion on genome | 171 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tcgctggccT |
tRNA gene sequence |
CGGGGCGTGGCGCAGCCTGGTAGCGCGCACCGTTCGGGTCGGTGAGGTCCCCGGTTCAAA |
Downstream region at tRNA end position |
ttcgctcgcg |
Secondary structure (Cloverleaf model) | >SRA1016430 Pro CGG T GAta ttcgctcgcg C C G - C G - C G - C G - C C - G G - C T A T G G G C C A C G A G | | | | | A C C G C G C C C G G C T | | | | T T G G C G C G T A G AGGTC C - G A - T C - G C - G G - C T T T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |