Sequence ID | >SRA1016432 |
Genome ID | SRR023846.494288 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 176 |
End posion on genome | 101 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
aacttcagat |
tRNA gene sequence |
GGGTCGTTAGCTCAGTCGGTAGAGCAGTTGACTTTTAATCAATTGGTCACAGGTTCGAAT |
Downstream region at tRNA end position |
attaaaacaa |
Secondary structure (Cloverleaf model) | >SRA1016432 Lys TTT t ACCA attaaaacaa G - C G - C G - C T - A C - G G - C T - A T A T T G T C C A T G A A | | | | | G C C T C G A C A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |