Sequence ID | >SRA1016436 |
Genome ID | SRR023846.496336 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 148 |
End posion on genome | 62 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
acctgcactc |
tRNA gene sequence |
GCGCGAGTGGCGGAATAGGCAGACGCGCACGGTTCAGGTCCGTGTGCCCGAAAGGGTGTG |
Downstream region at tRNA end position |
atccatgcag |
Secondary structure (Cloverleaf model) | >SRA1016436 Leu CAG c ACCG atccatgcag G - C C - G G - C C - G G - C A - T G - C T C T C C C C C A T A A G | | | | | A A G G C G G G G G G C G | | | T T G A C G C C A G G TGCCCGAAAGGGTGT C - G A - T C - G G - C G - C T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |