Sequence ID | >SRA1016443 |
Genome ID | SRR023846.499355 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 87 |
End posion on genome | 170 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gacccggttt |
tRNA gene sequence |
GGGGGAATGTCCCGAGCGGCAAAGGGGGCGGACTGTAAATCCGCTGCGTAAGCTTCGTAG |
Downstream region at tRNA end position |
aactccacgt |
Secondary structure (Cloverleaf model) | >SRA1016443 Tyr GTA t ACCA aactccacgt G - C G - C G - C G - C G - C A - T A - T T G T C A T C C A G A G G | | | | | G C C C C T G T A G G C G | | + T T G A G G G C A A G TGCGTAAGCTTC G - C C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |