Sequence ID | >SRA1016445 |
Genome ID | SRR023846.499728 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 193 |
End posion on genome | 269 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
cgctgtttca |
tRNA gene sequence |
GCGGGTGTAGCTCAGTTGGTTAGAGCGCCGGCCTGTCACGCCGGAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
tcgttcgnnn |
Secondary structure (Cloverleaf model) | >SRA1016445 Asp GTC a GCCA tcgttcgnnn G - C C - G G - C G + T G - C T - A G - C T G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |