Sequence ID | >SRA1016457 |
Genome ID | SRR023846.507950 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 300 |
End posion on genome | 225 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
taaatttatT |
tRNA gene sequence |
GGAAAAGTAGCTCAGTTGGTTAGAGTAATAGCTTGTCACGTTATATGTCGCGGGTTCAAA |
Downstream region at tRNA end position |
attttattta |
Secondary structure (Cloverleaf model) | >SRA1016457 Asp GTC T GTta attttattta G - C G - C A - T A - T A - T A - T G + T T A T T G C C C A T G A A + | | | | A T C T C G G C G G G C G | | | + T T G G A G T T T A A ATGTC A - T T - A A - T G + T C - G T C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |