Sequence ID | >SRA1016463 |
Genome ID | SRR023846.511490 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 100 |
End posion on genome | 176 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
gacgcagaac |
tRNA gene sequence |
GCGGGCGTAGCTCAGTTGGTTAGAGTGCCGGCCTGTCACGCCGGAGGTCGCGGGTTCGAG |
Downstream region at tRNA end position |
tggtcccgat |
Secondary structure (Cloverleaf model) | >SRA1016463 Asp GTC c GCCA tggtcccgat G - C C - G G - C G - C G - C C - G G - C C G T T G C C C A T G A A + | | | | G T C T C G G C G G G C G | | | + T T G G A G T T T A G AGGTC C - G C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |