Sequence ID | >SRA1016480 |
Genome ID | SRR023846.522768 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 178 |
End posion on genome | 254 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ttttctgatt |
tRNA gene sequence |
CTGTCCGTAGCTCAGTTGGATAGAGCATCGGCCTTCTAAGCCGAATGTCGGGGGTTCGAT |
Downstream region at tRNA end position |
aatcaagcgc |
Secondary structure (Cloverleaf model) | >SRA1016480 Arg TCT t GCCA aatcaagcgc C - G T - A G - C T - A C - G C - G G - C C T T C T C C C A T G A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A ATGTC T - A C - G G - C G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |