Sequence ID | >SRA1016481 |
Genome ID | SRR023846.523923 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 215 |
End posion on genome | 142 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
gctgaactta |
tRNA gene sequence |
AAGGAATTAGCTCAATTGGTTGAGCAACCGTTTTACACACGGAAGGTTAGGTGTTCGAGT |
Downstream region at tRNA end position |
gcttgaattt |
Secondary structure (Cloverleaf model) | >SRA1016481 Val TAC a ACac gcttgaattt A - T A - T G - C G - C A - T A - T T - A T G T T C C A C A T A A A | | | | | G T C T C G A G G T G C G | | | | T T G G A G C T T A AGGTT A A C - G C - G G - C T - A T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |