Sequence ID | >SRA1016493 |
Genome ID | SRR023846.529523 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 127 |
End posion on genome | 46 |
Amino Acid | Leu |
Anticodon | AAG |
Upstream region at tRNA start position |
aggtattgcT |
tRNA gene sequence |
GGTCAATTGGCCGAGCGGTCTAAGGCGCCAGTTTAAGGCACTGGTCCGAAAGGGCGTGGG |
Downstream region at tRNA end position |
gctgtttccc |
Secondary structure (Cloverleaf model) | >SRA1016493 Leu AAG T AGtt gctgtttccc G - C G - C T + G C - G A - T A - T T - A T A T C A C C C A C G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C C T A G TCCGAAAGGGC C - G C - G A - T G - C T - A T C T G A A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |