Sequence ID | >SRA1016508 |
Genome ID | SRR023846.537754 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 127 |
End posion on genome | 201 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gtcgacgagt |
tRNA gene sequence |
GCTGCCGTAGCTCAGTGGTAGAGCGCATCCTTGGTAAGGCTGAGGTCGTGAGTTCAATCC |
Downstream region at tRNA end position |
gtcttttttc |
Secondary structure (Cloverleaf model) | >SRA1016508 Thr GGT t ACCA gtcttttttc G - C C - G T - A G - C C - G C - G G - C C T T C A C T C A G A A | | | | | A T C T C G G T G A G C G | | | | T T G G A G C T A G AGGTC C - G A - T T C C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |