Sequence ID | >SRA1016515 |
Genome ID | SRR023846.540050 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 62 |
End posion on genome | 137 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
taaagcgctc |
tRNA gene sequence |
GGGCCTGTAGCTCAATGGTTAGAGCCGACCGCTCATAACGGTCTGGTTGCAGGTTCGAGT |
Downstream region at tRNA end position |
aacccatcat |
Secondary structure (Cloverleaf model) | >SRA1016515 Met CAT c ACCA aacccatcat G - C G - C G - C C - G C - G T + G G - C T G T C G T C C A T A A A | | | | | G G C T C G G C A G G C G | | | | T T T G A G C T A C TGGTT G - C A - T C - G C - G G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |