Sequence ID | >SRA1016517 |
Genome ID | SRR023846.540344 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 256 |
End posion on genome | 181 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
caaaggtatc |
tRNA gene sequence |
GGTTCTGTAGCTCAGCTGGTAGAGCAGTACACTTTTAATGTACGGGTCCTGGGTTCGAAT |
Downstream region at tRNA end position |
agtcctgcct |
Secondary structure (Cloverleaf model) | >SRA1016517 Lys TTT c ACTA agtcctgcct G - C G - C T + G T - A C - G T + G G - C T A T G A C C C A C G A A | | | | | G T C T C G C T G G G C G | | | | T T G G A G C T A A GGGTC G - C T - A A - T C - G A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |