Sequence ID | >SRA1016522 |
Genome ID | SRR023846.542854 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 154 |
End posion on genome | 229 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
catcccgaga |
tRNA gene sequence |
GGGCGCTTAGCTCAGCTGGTAGAGCGGCTCGTTTACACCGAGTAGGTCGGCGGTTCGAAC |
Downstream region at tRNA end position |
tatctcccga |
Secondary structure (Cloverleaf model) | >SRA1016522 Val TAC a ACCA tatctcccga G - C G - C G - C C - G G - C C - G T - A C A T C T G C C A C G A A | + | | | G T C T C G G G C G G C G | | | | T T G G A G C T A G AGGTC G + T C - G T - A C - G G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |