Sequence ID | >SRA1016525 |
Genome ID | SRR023846.543526 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 118 |
End posion on genome | 43 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gctccggtgc |
tRNA gene sequence |
GCCCCCGTAGCTCAGGGGATAGAGCGTCCGCCTCCGGAGCGGAAGGCCGCAGGTTCGAAT |
Downstream region at tRNA end position |
atcactcgcc |
Secondary structure (Cloverleaf model) | >SRA1016525 Arg CCG c ACCC atcactcgcc G - C C - G C - G C - G C - G C - G G - C T A T C G T C C A G G A A | | | | | G G C T C G G C A G G C G | | | | T T A G A G C T A G AGGCC T - A C - G C - G G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |