Sequence ID | >SRA1016534 |
Genome ID | SRR023846.547358 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 181 |
End posion on genome | 105 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
cccgttcggt |
tRNA gene sequence |
CGGAGCGTAGCGCAGCCTGGTAGCGCACCACACTGGGGGTGTGGGGGTCGCAGGTTCGAA |
Downstream region at tRNA end position |
ttttcttaca |
Secondary structure (Cloverleaf model) | >SRA1016534 Pro GGG t ACCA ttttcttaca C - G G - C G - C A - T G - C C - G G - C T A T T G T C C A C G A A + | | | | G C C G C G G C A G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G A - T C - G A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |