Sequence ID | >SRA1016535 |
Genome ID | SRR023846.547859 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 244 |
End posion on genome | 161 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
cggcggacgc |
tRNA gene sequence |
GCCGGTGTGGCGGAATGGCAGACGCGGAGCACTCAAAATGCTTTGTCGAAAGACGTGTGG |
Downstream region at tRNA end position |
caaatgcggc |
Secondary structure (Cloverleaf model) | >SRA1016535 Leu CAA c ACCA caaatgcggc G + T C - G C - G G - C G - C T - A G - C T G T C A C C C A T A A G | | | | | G G G G C G G T G G G C G | | | T T C A C G C A G G TGTCGAAAGACGT G + T A - T G - C C - G A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |