Sequence ID | >SRA1016542 |
Genome ID | SRR023846.552361 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 146 |
End posion on genome | 222 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcctgggctc |
tRNA gene sequence |
GGCTCTTTAGCTCAGTCGGTTAGAGCGATGGAATCATAATCCACAGGTCCGCGGTTCGAA |
Downstream region at tRNA end position |
acnnnnnnnn |
Secondary structure (Cloverleaf model) | >SRA1016542 Met CAT c ACCA acnnnnnnnn G - C G - C C - G T - A C - G T - A T - A T A T G T G C C A T G A A | + | | | G C C T C G C G C G G C G | | | | T T G G A G C T T A G AGGTC A C T - A G - C G - C A - T A A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |