Sequence ID | >SRA1016554 |
Genome ID | SRR023846.562660 |
Phylum/Class | Community proteogenomics reveals insights into the physiology of phyllosphere bacteria (SRP001120) |
Species | |
Start position on genome | 112 |
End posion on genome | 187 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
gtcccgatca |
tRNA gene sequence |
GGGCGATTGGCGCAGTTGGTAGCGCGCTTCCTTCACACGGAAGAGGTCATCGGTTCGAGT |
Downstream region at tRNA end position |
cgtagttccc |
Secondary structure (Cloverleaf model) | >SRA1016554 Val CAC a ACCA cgtagttccc G - C G - C G - C C - G G - C A - T T - A T G T T G G C C A T G A G | + | | | G T C G C G A T C G G C G | | | | T T G G C G C T A G AGGTC C - G T - A T - A C - G C - G T C T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [SRA] |
Comment | |
--- | |
Input Comment |