The detailed information of tRNA gene sequence


Sequence ID>C151009093
Genome IDCP006270
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. KORDI-49
Start position on genome 1166141
End posion on genome 1166059
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
agtcgaccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCACtc
Downstream region at tRNA end position
cattctcttg
Secondary structure (Cloverleaf model)
>C151009093	Leu	GAG
                   c      ACtc cattctcttg
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK