The detailed information of tRNA gene sequence


Sequence ID>C151013895
Genome IDCP006882
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. WH 8109
Start position on genome 346886
End posion on genome 346957
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
aacggatcga
tRNA gene sequence
TGGGCCGTCGCCAAGTGGTAAGGCAGCGGGTTTTGGTCCCGCCATTCCTAGGTTCGAATC
CTAGCGGCCCAGttt
Downstream region at tRNA end position
ttgtccatga
Secondary structure (Cloverleaf model)
>C151013895	Gln	TTG
                   a      Gttt ttgtccatga
                     T - A
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C          T A
                    T     G A T C C     A
        G A        C      | | | | |     G
      T     A C C G       C T A G G     C
      G       | | |                 T T
      G     A G G C
        T A        A     CATTC
                    G - C
                    C - G
                    G - C
                    G - C
                    G - C
                  T       T
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK