The detailed information of tRNA gene sequence


Sequence ID>C151013914
Genome IDCP006882
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. WH 8109
Start position on genome 1754533
End posion on genome 1754452
Amino Acid Leu
Anticodon GAG
Upstream region at tRNA start position
agtcgaccac
tRNA gene sequence
GCGGATGTGGTGGAATTGGTAGACACGCACGTTTGAGGGGCGTGTGGCTTCGGCCTTGCG
AGTTCAAGTCTCGCCATCCGCAttt
Downstream region at tRNA end position
ttttctttgg
Secondary structure (Cloverleaf model)
>C151013914	Leu	GAG
                   c      Attt ttttctttgg
                     G - C
                     C - G
                     G - C
                     G - C
                     A - T
                     T - A
                     G - C          T G
                    T     C G C T C     A
      T A A        G      | | | | |     A
    T       G G T G       G C G A G     C
    G         | | |                 T T
    G       A C A C
      T A G        G     TGGCTTCGGCCTT
                    C - G
                    A - T
                    C - G
                    G - C
                    T + G
                  T       G
                  T       G
                    G A G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK