The detailed information of tRNA gene sequence


Sequence ID>C151013930
Genome IDCP006882
Search identical group
Phylum/ClassCyanobacteria
SpeciesSynechococcus sp. WH 8109
Start position on genome 325100
End posion on genome 325010
Amino Acid Ser
Anticodon GCT
Upstream region at tRNA start position
gtgcgccgcT
tRNA gene sequence
GGAGAGGTGGCTGAGTGGTTGAAAGCGGCTCCCTGCTAAGGAGTTACAGGAGGCAACTTC
TGTCGAGGGTTCGAATCCCTCCCTCTCCGTtc
Downstream region at tRNA end position
caagttcatt
Secondary structure (Cloverleaf model)
>C151013930	Ser	GCT
                   T      GTtc caagttcatt
                     G - C
                     G - C
                     A - T
                     G - C
                     A - T
                     G - C
                     G - C          T A
                    T     C T C C C     A
      T G A        G      | | | | |     G
    G       G T C G       G A G G G     C
    G         | | |                 T T
    T       A A G C
      T G A        G     TACAGGAGGCAACTTCTGTC
                    G + T
                    C - G
                    T - A
                    C - G
                    C - G
                  C       A
                  T       A
                    G C T
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK