| Sequence ID | >SRA1019489 |
| Genome ID | SRR035082.465660 |
| Phylum/Class | 454 Sequencing (SRP001803) |
| Species | |
| Start position on genome | 318 |
| End posion on genome | 244 |
| Amino Acid | His |
| Anticodon | GTG |
| Upstream region at tRNA start position |
taagataatg |
| tRNA gene sequence |
GTGAGTGTAGCTCAGTTGGTTAGAGCTCTGGATTGTGGTTCCAGTTGTCGCCGGTTCGAA |
| Downstream region at tRNA end position |
ctttgggaat |
| Secondary structure (Cloverleaf model) | >SRA1019489 His GTG
g CCtg ctttgggaat
G - C
T - A
G - C
A - T
G - C
T - A
G - C T A
T T G G C C A
T G A A + | | | | G
T C T C G G C C G G C
G | | | | T T
G G A G C
T T A T TTGTC
C - G
T - A
G - C
G - C
A - T
T T
T G
G T G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |