| Sequence ID | >C151032413 |
| Genome ID | CP007698 |
| Phylum/Class | Alphaproteobacteria |
| Species | Brucella suis bv. 2 Bs364CITA [CP007697, CP007698] |
| Start position on genome | 1273285 |
| End posion on genome | 1273209 |
| Amino Acid | Ile |
| Anticodon | GAT |
| Upstream region at tRNA start position |
gtcggtatct |
| tRNA gene sequence |
GGGCTTGTAGCTCAGTTGGTTAGAGCACACGCTTGATAAGCGTGGGGTCGGAGGTTCAAG |
| Downstream region at tRNA end position |
agttacttga |
| Secondary structure (Cloverleaf model) | >C151032413 Ile GAT
t ACCA agttacttga
G - C
G - C
G - C
C - G
T + G
T - A
G - C T G
T C C T C C A
T G A A | | | | | A
T C T C G G G A G G C
G | | | | T T
G G A G C
T T A A GGGTC
C - G
A - T
C - G
G - C
C - G
T A
T A
G A T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [Ensembl] |
| Comment | |
| --- | |
| Input Comment |