The detailed information of tRNA gene sequence


Sequence ID>C151056013
Genome IDCP009621
Search identical group
Phylum/ClassBacteroidetes
SpeciesPontibacter korlensis X14-1T
Start position on genome 2392618
End posion on genome 2392545
Amino Acid Gln
Anticodon TTG
Upstream region at tRNA start position
gtagggagat
tRNA gene sequence
TGTCCGATGGTGTAACTGGCAACACGTCTGATTTTGGTTCAGAAGAGTCCAGGTTCGAGC
CCTGGTCGGACAACtt
Downstream region at tRNA end position
taaaagaaca
Secondary structure (Cloverleaf model)
>C151056013	Gln	TTG
                   t      ACtt taaaagaaca
                     T - A
                     G - C
                     T - A
                     C - G
                     C - G
                     G - C
                     A - T          C G
                    T     G G T C C     A
      C A A        G      | | | | |     G
    T       T G T G       C C A G G     C
    G       | | | |                 T T
    G       A C A C
      C A          G     AGAGT
                    T - A
                    C - G
                    T - A
                    G - C
                    A - T
                  T       T
                  T       G
                    T T G
Intron
Comment/Decision
Genome/Seq. Info.[Ensembl]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK