| Sequence ID | >SRA1025621 |
| Genome ID | SRR035085.51902 |
| Phylum/Class | 454 Sequencing (SRP001806) |
| Species | |
| Start position on genome | 164 |
| End posion on genome | 88 |
| Amino Acid | Ala |
| Anticodon | GGC |
| Upstream region at tRNA start position |
aaactatctt |
| tRNA gene sequence |
GGGCCTGTGGCGCAATTGGTTAGCGTACTTCGATGGCATCGAAGGGGTTGTGGGTTCGAA |
| Downstream region at tRNA end position |
cataatatct |
| Secondary structure (Cloverleaf model) | >SRA1025621 Ala GGC
t ACCA cataatatct
G - C
G - C
G + T
C - G
C - G
T - A
G - C T A
T T A C C C A
T A A G + | | | | G
T C G C G G T G G G C
G | | | + T T
G G C G T
T T A A GGGTT
C - G
T - A
T - A
C - G
G - C
A T
T A
G G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |