| Sequence ID | >SRA1025884 |
| Genome ID | SRR035085.102136 |
| Phylum/Class | 454 Sequencing (SRP001806) |
| Species | |
| Start position on genome | 126 |
| End posion on genome | 51 |
| Amino Acid | Ala |
| Anticodon | GGC |
| Upstream region at tRNA start position |
aaaaattaaa |
| tRNA gene sequence |
GGGGCTGTAGCTCAGATGGGAGAGCGCATGACTGGCAGTCATGAGGTCAGGGGTTCGATC |
| Downstream region at tRNA end position |
gatgtcttta |
| Secondary structure (Cloverleaf model) | >SRA1025884 Ala GGC
a ACCA gatgtcttta
G - C
G - C
G + T
G - C
C - G
T - A
G - C C T
T T C C C C A
A G A A | | | | | G
T C T C G A G G G G C
G | | | | T T
G G A G C
G A G AGGTC
C - G
A - T
T - A
G - C
A - T
C G
T A
G G C
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |