| Sequence ID | >SRA1025935 |
| Genome ID | SRR035085.113245 |
| Phylum/Class | 454 Sequencing (SRP001806) |
| Species | |
| Start position on genome | 370 |
| End posion on genome | 296 |
| Amino Acid | Asn |
| Anticodon | GTT |
| Upstream region at tRNA start position |
atttttttgt |
| tRNA gene sequence |
TGCTAGGTAGTTCAGTGGTAGAACGCTACGCTGTTAACGTAGATGTCGCTGGTTCGAATC |
| Downstream region at tRNA end position |
ttttttaaaa |
| Secondary structure (Cloverleaf model) | >SRA1025935 Asn GTT
t GCCA ttttttaaaa
T - A
G - C
C - G
T - A
A - T
G - C
G - C T A
T C G A C C A
G A A | | | | | G
T C T T G G C T G G C
G | | | | T T
G G A A C
T A G ATGTC
C - G
T - A
A - T
C - G
G - C
C A
T A
G T T
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [SRA] |
| Comment | |
| --- | |
| Input Comment |